The Spectral Properties of the Telomere Fragments

Authors

  • V. Yu. Kudrya Faculty of Physics, Taras Shevchenko National University of Kyiv
  • V. M. Yashchuk Faculty of Physics, Taras Shevchenko National University of Kyiv
  • I. Ya. Dubey Institute of Molecular Biology and Genetics, Nat. Acad. of Sci. of Ukraine
  • K. I. Kovalyuk Faculty of Physics, Taras Shevchenko National University of Kyiv
  • O. I. Batsmanova Faculty of Physics, Taras Shevchenko National University of Kyiv
  • V. I. Mel’nik Institute of Physics, Nat. Acad. of Sci. of Ukraine
  • G. V. Klishevich Institute of Physics, Nat. Acad. of Sci. of Ukraine
  • A. P. Naumenko Faculty of Physics, Taras Shevchenko National University of Kyiv
  • Yu. M. Kudrya Faculty of Physics, Taras Shevchenko National University of Kyiv

DOI:

https://doi.org/10.15407/ujpe61.06.0516

Keywords:

optical absorption, phosphorescence, adenine chromophore, thymine chromophore, oligonucleotide d(AGGGTTAGGGTTAGGGTTAGGG)

Abstract

The optical absorption and phosphorescence (at low temperatures) of a telomere fragment (oligonucleotide d(AGGGTTAGGGTTAGGGTTAGGG)) and (for comparing) the DNA macromolecule are investigated under various excitation wavelengths (240–300 nm). Two types of d(AGGGTTAGGGTTAGGGTTAGGG) samples were studied: (1) the intact sample, and (2) the sample heated to 90 ∘C and studied immediately after heating. It is concluded that the main traps of triplet electronic excitations in both these samples of d(AGGGTTAGGGTTAGGGTTAGGG), as well as DNA, are the complexes formed by neighbor adenine (A) and thymine (T) chromophores from the same strand (not from complementary chromophores of the different strands).

References

V. Yashchuk, V. Kudrya, M. Losytskyy, H. Suga, and T. Ohul'chanskyy, J. of Mol. Liq. 127, 79 (2006). https://doi.org/10.1016/j.molliq.2006.03.020

V.M. Yashchuk, V.Yu. Kudrya, M.Yu. Losytskyy, I.Ya. Dubey, and H. Suga, Mol. Cryst. Liq. Cryst. 467, 311 (2007). https://doi.org/10.1080/15421400701224751

V.Yu. Kudrya, V.M. Yashchuk, Ukr. J. Phys. 57, 187 (2012).

Downloads

Published

2019-01-06

Issue

Section

Soft matter

How to Cite

The Spectral Properties of the Telomere Fragments. (2019). Ukrainian Journal of Physics, 61(6), 516. https://doi.org/10.15407/ujpe61.06.0516

Most read articles by the same author(s)

1 2 > >>